Fri. Jun 21st, 2024

Results may also be extrapolated to other species, confirming the need to consider the relationship of animal populations and their native biome in commercial agriculture and in natural environments

GACTCCCCGTCG GCAGAGCGAGGTATGTAGG CAGGAAAGAACATGTGAGC TCTAGAGTCGACCTGCAGG GAAAAGCAAACAAGAAAGGGG CAAACCACAACTAGAATGCAG CAAGGCCTCTCACTCTCTG B - GPRT amplicons sequencing primers Primer name Sequence 59-39 F1 F2 F3 F5 GAGAGCTTCAGGTTTGGGG AATTGGGCCTGAAAATCC CCTCCATTCCTTTGGATGGG CACTCTTTGGCAACGACCC Primer name F4 F6 F7…