GACTCCCCGTCG GCAGAGCGAGGTATGTAGG CAGGAAAGAACATGTGAGC TCTAGAGTCGACCTGCAGG GAAAAGCAAACAAGAAAGGGG CAAACCACAACTAGAATGCAG CAAGGCCTCTCACTCTCTG B – GPRT amplicons sequencing primers Primer name Sequence 59-39 F1 F2 F3 F5 GAGAGCTTCAGGTTTGGGG AATTGGGCCTGAAAATCC CCTCCATTCCTTTGGATGGG CACTCTTTGGCAACGACCC Primer name F4 F6 F7 F8 Sequence 59-39 CAGACCAGAGCCAACAGCCCC GGTACAGTATTAGTAGGACC GTACTGGATGTGGGTGATGC GTGGGAAAATTGAATTGGG 6 May 2011 | Volume 6 | Issue 5 | e19643 HIV-1 Subtype B and C Backbone Phenotyping B – GPRT amplicons sequencing primers Primer name Sequence 59-39 R1 R3 R5 R6 CTCCCACTCAGGAATCC CTTCCCAGAAGTCTTGAGTTC GGGTCATAATACACTCCATG GGAATATTGCTGGTGATCC Primer name R2 R4 R7 R8 18316371 Sequence 59-39 GTACTGTCCATTTATCAGG CTAACTGGTACCATAATTTCACTAAGGGAGG CATTGTTTAACTTTTGGGCC GATAAAACCTCCAATTCC doi:10.1371/journal.pone.0019643.t002 sequence. In total, 23 clones bearing resistance mutations, were retained for further processing. Only one clone of sample 8 was retained and used as a subtype C wild-type reference to calculate fold-changes. 2. Phenotypic characteristics of HIV-1 subtype C and subtype B recombinant virus stocks The HIV-1 subtype C virus stock cultures were monitored on a daily basis for spread of infection, viral load and p24 production. Some viruses replicated very fast and infected almost all cells within 7 days. A majority however, replicated slowly and needed up to 18 days to infect all cells. No clear cytopathogenic effect was observed among the HIV-1 subtype C-infected cells and hence spread of infection needed to be monitored on the basis of fluorescence. As an example, the complete monitoring of the clones of sample 4 is shown in Fig. 3. Here, a gradual KN93 phosphate manufacturer increase of fluorescence in cell clusters could be observed from day 4 over day 6 to the final point on day 11 where the RVS was harvested. As in the example, harvesting occurred at the moment where nearly all cell clusters were completely fluorescent, which coincided with the moment at which no or a smaller increase in viral load was measured compared to the previous day. Similar curves were observed for p24 measurements. On average, a 3.02 log 60.61 increase in VL and a 1.94 log 60.42 increase in p24 production was observed. After harvesting the subtype C viruses, RNA was extracted, amplified and recombined into an HIV-1 subtype B backbone. The resulting recombinant viruses were sequenced to ensure a complete mutation analysis of the GPRT region. The corresponding HIV-1 subtype B clones grew faster compared to HIV-1 subtype C and gave clear CPE. One amplicon failed to generate a replicating virus after transfection in the subtype B backbone. 3. Genotypic analysis of HIV-1 GPRT subtype C sequence in the subtype C and subtype B backbones Identical GPRT sequences were found for all virus stocks derived from the same amplicon except for one clone lacking 184V. All genotypes remained unaltered during the process of re-culturing in either backbone. 4. Antiviral drug susceptibility testing of virus stocks generated with the pGEM-HIV-1-C-Dgprt-BstEII vs. the pGEM-HXB2-Dgprt-BstEII backbones but carrying identical GPRT fragments Fold-change values were calculated by dividing the IC50 values of the virus stocks harboring RAMs 7 May 2011 |
Volume 6 | Issue 5 | e19643 HIV-1 Subtype B and C Backbone Phenotyping 8 May 2011 | Volume 6 | Issue 5 | e19643 HIV-1 Subtype B and C Backbone Phenotyping by the IC50 values of the corresponding backbone with wild-type amplicon. Scatter plots showing the re